Skip navigation
Skip navigation

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

Owen, Elisabeth; Keniry, Max

Description

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B....[Show more]

dc.contributor.authorOwen, Elisabeth
dc.contributor.authorKeniry, Max
dc.date.accessioned2015-12-07T22:18:30Z
dc.identifier.issn0004-9425
dc.identifier.urihttp://hdl.handle.net/1885/18840
dc.description.abstractCalothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.
dc.publisherCSIRO Publishing
dc.sourceAustralian Journal of Chemistry
dc.subjectKeywords: 2-aminopurine (2AP); Anti-proliferative; Calothrix; Cancer cell lines; Dissociation constant; DNA quadruplexes; Double stranded DNA; Fluorescence emission; G-quadruplexes; In-vitro; Methoxymethyl; Monitoring change; Order of magnitude; Preferential bindin
dc.titleExploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor
dc.typeJournal article
local.description.notesImported from ARIES
local.identifier.citationvolume62
dc.date.issued2009
local.identifier.absfor030499 - Medicinal and Biomolecular Chemistry not elsewhere classified
local.identifier.ariespublicationu2544221xPUB6
local.type.statusPublished Version
local.contributor.affiliationOwen, Elisabeth, College of Physical and Mathematical Sciences, ANU
local.contributor.affiliationKeniry, Max, College of Physical and Mathematical Sciences, ANU
local.description.embargo2037-12-31
local.bibliographicCitation.issue11
local.bibliographicCitation.startpage1544
local.bibliographicCitation.lastpage1549
local.identifier.doi10.1071/CH09169
dc.date.updated2016-02-24T09:51:33Z
local.identifier.scopusID2-s2.0-70749126847
local.identifier.thomsonID000271976400017
CollectionsANU Research Publications

Download

File Description SizeFormat Image
01_Owen_Exploring_the_Binding_of_2009.pdf452.32 kBAdobe PDF    Request a copy


Items in Open Research are protected by copyright, with all rights reserved, unless otherwise indicated.

Updated:  19 May 2020/ Responsible Officer:  University Librarian/ Page Contact:  Library Systems & Web Coordinator