Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor
-
Altmetric Citations
Description
Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B....[Show more]
Collections | ANU Research Publications |
---|---|
Date published: | 2009 |
Type: | Journal article |
URI: | http://hdl.handle.net/1885/18840 |
Source: | Australian Journal of Chemistry |
DOI: | 10.1071/CH09169 |
Download
File | Description | Size | Format | Image |
---|---|---|---|---|
01_Owen_Exploring_the_Binding_of_2009.pdf | 452.32 kB | Adobe PDF | Request a copy |
Items in Open Research are protected by copyright, with all rights reserved, unless otherwise indicated.
Updated: 19 May 2020/ Responsible Officer: University Librarian/ Page Contact: Library Systems & Web Coordinator