Skip navigation
Skip navigation

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

Owen, Elisabeth; Keniry, Max


Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B....[Show more]

CollectionsANU Research Publications
Date published: 2009
Type: Journal article
Source: Australian Journal of Chemistry
DOI: 10.1071/CH09169


File Description SizeFormat Image
01_Owen_Exploring_the_Binding_of_2009.pdf452.32 kBAdobe PDF    Request a copy

Items in Open Research are protected by copyright, with all rights reserved, unless otherwise indicated.

Updated:  19 May 2020/ Responsible Officer:  University Librarian/ Page Contact:  Library Systems & Web Coordinator